Evolutionary miracles and the chemical basis of life
4. THE MUTATION THEORY 4.2 Proteins 4.3 The structure of DNA 4.4 The genetic code 4.5 Mutations 4.6 Mutations – evolutionary miracles?
Mendel was a big problem for the evolution theory. Partly because of that fact, it took a long time before people wanted to accept his findings, since it meant something else was necessary to cause infinite variation, to pull species over their own natural borders. The alternative came in the form of mutation. A ‘new’ hereditary attribute sometimes seems to appear for no reason, seemingly out of nowhere. Afterwards, this ‘new’ attribute behaves according to the laws of Mendel. The spontaneous generation of these ‘new’ attributes is caused by mutations.
In order to understand what mutation is and how it works, we need to look at how DNA is put together and what proteins are. That this is a fascinating world can be seen in the virtual conversation I had with Cor Boonstra...
4.1 Cor Boonstra’s ideal When I last played golf [1], I saw Cor Boonstra, you know, the boss of Philips. ‘Hey,’ he said, ‘you’re Peter, aren’t you?’ ‘Yes,’ I said, ‘and you’re Cor. I may call you Cor, right?’ ‘Yes, of course,’ he said, ‘I like your TV programs.’ ‘Thanks?’ I said, and that started a conversation. Of course, I was very interested to hear from him what his future plans were for Philips, since I had heard some bits and pieces from the people in the church I go to. He was surprised that I knew about it and was interested, so he enthusiastically began to tell me about it. However, I could not have suspected that the future plans being cooked up in the higher realms of the Philips management would have such far-reaching consequences for our existence.
Philips is building a new factory for the so-called IIRT project, which stands for Integration of Informational & Robotics Technology. It will be an innovative combination of software (Informational) and mechanical (Robotic) automation. You are probably familiar with robots. They are smart tools, which can, with great precision and constant self-correction, place parts on, for instance, an automobile. Robots do this much faster than humans could and do not need a lunch break. This automation of the production process has already been widely implemented, but a need has arisen for a more flexible production process. It was already the case that a robot could be programmed to carry out a certain task. What Cor now wants is a completely automated flexible production process by which market developments can be actively anticipated by the factories of the future which will not only put together a specific finished product, but also the robots that supervise the production process. And to make those robots, you need (that’s right) robots! Why?
Robots, no matter how advanced they are, are also highly specialized. There are robots that can screw ten tiny screws simultaneously into a circuit board in order to affix it. There are robots that can carry a pallet of TV’s to the storeroom. There are very many different tasks, and just as many different robots are needed. You could make multifunctional robots, but they are very expensive and are not used efficiently if they are only performing one simple task. It is not possible to have a series of robots on hand for every possible task in a specific production process. However, most of the parts of the robots are the same, and can be used in various production processes. What is Philips intending to do? They intend to recycle all those robots! They will be completely dismantled and the parts will be reused to make new robots, exactly the kind needed at that time. If there are robots that have nothing to do because there are too many robots for a specific task, they are taken apart by special disassembly robots. If there is a shortage of a certain kind of robot, there is a diagnostic robot which reports to the robot assembly department, which then finds the blueprint for that particular robot, which is then put together. Yet another diagnostic robot notices that the bottleneck in the production line is solved and it ensures that the assembly of the robots necessary for that solution is stopped. Even the robots that make robots are put together in the assembly hall by robots!
 |
The whole factory works that way. Purchasing, billing, and accounting are done by accounting robots, which just sit on a table and are connected to the Internet and the bank network (they look a lot like our computers, but without a keyboard or monitor). Logistic robots unload the trucks which bring parts entirely independently, to the complete satisfaction of the driver, and they reload the trucks which come to pick up the finished products. Of course the robot parts wear out, but they also are put on the requisition lists completely automatically when certain robots ascertain that it is necessary. In the end, all Cor has to do is to push a button and say: so much of this, so much of that, and it happens. If necessary, the entire factory is rebuilt by specially designed robots. The production line needs to be structurally twice as big? Construction robots copy the whole factory on a larger scale in the factory next to it! And there the whole story starts over. Structural over-capacity? And just like that, the whole building is torn down and used for something else. When he revealed this story to me, of course I was surprised. ‘But how far does that go?’ I asked. ‘Very,’ he said, ‘When our first factory is done, more will follow. The connections between the factories will also be automated. Later, the truck driver will be a robot, with a built-in route planner and satellite navigation so it always knows its way around. Even if it were hijacked and set down somewhere else, it would be able to find a way back. DAF is already working on a truck without a cabin, with a built-in robot, and the Dutch Automobile Association is laying fiberglass cables along the roads to send data to the cars, so that the central traffic control can be done by robots. It’s the new solution to traffic jams on the highway! Hahaha.’ he laughed. ‘But...,’ I said, but I was speechless. What should I say? ‘But...,’ It dizzied me. ‘But, how did you come up with the idea?’ Luckily, this question came to mind, or I would have momentarily been at a loss to handle the situation, and I didn’t want to make a bad impression at our first meeting. ‘Ohhh,’ he said, ‘we got that from Living nature.’ ‘From Living nature?’ I asked, surprised. ‘Yes, certainly. Just look at the cells in your body. They are exactly that kind of factories; they are fully automated. And proteins...,’ he paused briefly to give his words emphasis, ‘proteins are nothing more than those super-specialized, recyclable ROBOTS, programmed by genes.’ I fell over from surprise. ‘Do you want to go get a cup of coffee?’ he asked. ‘No, no,’ I answered as I shook my head, ‘I think I need to process this. It was nice talking to you.’ And now he looked at me oddly, at such an obvious lack of spontaneous comprehension of his lucid exposition.
 |
figure 1. A robot protein (Make-A-Model protein) grasping a piece of DNA (dark gray) in order to make a model of it.
4.2 Proteins Genes are the blueprints for the proteins on which almost all life is based. Proteins do pretty much everything: the growth of a fertilized egg cell, from embryo to organism; the metabolism; the struggle against intruders and germs; the entire organization in cells, organs, and muscles, and more. All that is done by proteins, which are in fact biochemical robots. They are also called hormones or enzymes (although not all hormones are proteins), and there are almost 100,000 of them in the human body. These proteins are assembled in the cells of the body, the Cor Boonstra factories. Some proteins are needed in every cell, but many are made in specialized factories, such as the liver cells or special glands.
Not every conceivable protein is useful. Proteins are built up out of individual parts, the amino acids. One protein is made up of hundreds or even thousands of amino acids, and there are twenty different amino acids. If you haphazardly put a protein together by sticking amino acids together arbitrarily, you get (for instance in a protein with 300 amino acids) 20300 possibilities, that is approximately 2x10390. And that is:
2.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000. 000.000.000.000.000.000.000.000.000.000.000
If you imagine that the entire universe has about 1080 atoms, that is:
1.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000.000. 000.000.000.000.000.000.000.000.000.000.000.000
then you understand that it is impossible to put proteins together arbitrarily and hope that there are a few good ones. And that is precisely what the genes are for, the blueprints for the protein robots. They code for proteins. In living cells, the genes are used to produce proteins. And how are these proteins produced? Exactly, with the help of special proteins! And how are these proteins produced? By the self-same special proteins! These are robots that put each other together.
 |
figure 2. An example of the complex structure of proteins |
Proteins are not just long chains of amino acids. 1.The amino acid chain is only the first of four structural layers of the protein. 2.The second structure is the folding up of the chain into two possible basic ‘figures’: spirals or a zigzag structure. 3.The third structure folds it again, into a complex three-dimensional figure. 4.Lastly, several of these complex structures are joined to form the final protein. The three ‘higher’ structures are almost completely determined by the order of the amino acids.
In this way, three-dimensional forms are created, which could for instance literally take hold of a strand of DNA and pull apart the two ‘tracks’, so that the information could be read. In this way they are literally robots.
Is insulin suddenly needed? A regulator protein knocks on the door of the organ that makes insulin, is admitted, and wakes up the gene that has the code for insulin. The Make-A-Model proteins[2] make a model[3] of the gene and, using the model, the necessary insulin is made by Make-A-Protein robots[4].
4.3 The structure of DNA How do the genes code for a certain protein? Genes are pieces of DNA, and the structure of DNA can be compared with a train track with rails. The two rails are connected by wooden crossbars. A DNA track is curled up in a spiral (see Figure 1). The rails are a sort of chemical backbone for the DNA. The ‘crossbars’ are made up of base pairs. There are four bases: Thymine (T), Adenine (A), Cytosine (C) en Guanine (G). These always appear in pairs in the DNA. T and A (with two hydrogen bonds) are always opposite to each other, and C and G are always opposite to each other (with three hydrogen bonds). They are the letters of the genetic alphabet. First, a model of the DNA is made, called RNA, but that model looks very much like the DNA, and the letters are the same. Three ‘letters’ in the RNA form a genetic ‘word’, called codon, for instance ATG or CTT. One word, or codon, in the RNA corresponds to one amino acid in a protein. This means that the sequence of amino acids in a protein is completely determined by the sequence of A’s, C’s, G’s and T’s in the DNA. It resembles the zeros and ones of a computer program.
|
|
|
Figure 3. The structure of the DNA, Cell and molecular biology, pp. 67 |
 |
|
Figure 4. An unraveled chromosome; the arrow clearly indicates a strand of DNA, Cell and molecular biology pp. 416. |
4.4 The genetic code So how many words are in the genetic dictionary? Sixty-four, because 4x4x4 (letters) = 64. And how many amino acids (robot parts) are there? Twenty. So sixty-four words are more than enough to indicate twenty amino acids. What if a word had two letters? Then there would be 4x4=16 words, not enough to indicate all the amino acids. 64 is the next number that suffices. Four-letter words would result in 256 possibilities and that is far too much. So it is 64.[5]
But 64 is too much. What do we do with the other 44? Well, these also indicate amino acids, and in such a way that, should a letter accidentally change, in most cases the same amino acid is indicated. Most of the time, the third letter can differ. Furthermore, a ‘period’ is necessary to finish a ‘sentence’ of amino acid-words, or rather to show where the protein production should stop. There are three of these ‘periods’, and a starting mark to signal the beginning of the information. In Figure 4, you can see a table of all the words and which amino acids belong to them. (The T is replaced by U for Uracil in the table, because that is what is used in the ‘model’, the RNA.) This table is called the genetic code.
 |
| Figure 5. The genetic code: Rosetta Stone of molecular genetics |
Suppose, for convenience’ sake, we make a new table, with the twenty most used letters of our alphabet.
|
|
AGA |
|
|
|
|
|
|
|
|
TTA |
|
|
|
|
AGC |
|
|
|
|
|
|
|
AGG |
|
|
|
|
|
|
|
|
TTG |
|
|
|
|
AGT |
|
|
|
|
|
|
GCA |
CGA |
|
|
|
|
|
GGA |
|
|
CTA |
|
|
|
CCA |
TCA |
ACA |
|
|
GTA |
|
|
GCC |
CGC |
|
|
|
|
|
GGC |
|
ATA |
CTC |
|
|
|
CCC |
TCC |
ACC |
|
|
GTC |
TAA |
|
GCG |
CCG |
GAC |
AAC |
TGC |
GAA |
GAA |
GGG |
CAC |
ATC |
CTG |
AAA |
|
TTG |
CCG |
TCG |
ACG |
|
TAC |
GTG |
TAG |
|
GCT |
CGT |
GAT |
AAT |
TGT |
GAG |
GAG |
GGT |
GAT |
ATT |
CTT |
AAG |
ATG |
TTT |
CCT |
TCT |
ACT |
TGG |
TAT |
GTT |
TGA |
|
a |
e |
b |
d |
f |
g |
h |
i |
j |
k |
o |
l |
m |
p |
r |
n |
s |
t |
u |
v |
stop |
Now we need hemoglobin in our body. What would the gene that codes for that look like? For instance, like this:
ATGCAGCGAATGTTTGAGAAGCTCGATGGCTCGTAG
Cut it up into segments of three:
ATG CAG CGA ATG TTT GAG AAG CTC GAT GGC TCG TAG
and match the letters up
|
ATG |
CAG |
CGA |
ATG |
TTT |
GAG |
AAG |
CTC |
GAT |
CGC |
TCG |
TAG |
|
start |
h |
e |
m |
o |
g |
l |
o |
b |
i |
n |
. |
As you can see, it codes for ‘hemoglobin’ (in reality, it is much longer)[6]
4.5 Mutations Now we are going to see what happens when something changes in a gene.We change one genetic letter, and watch what happens:
|
ATG |
CAG |
CGA |
ATG |
TTT |
GAA |
AAG |
CTC |
GAT |
CGC |
TCG |
TAG |
|
start |
h |
e |
m |
o |
g |
l |
o |
b |
i |
n |
. |
It makes no difference! Another letter changes:
|
ATG |
CAG |
CGA |
ATG |
TTT |
GGG |
AAG |
CTC |
GAT |
CGC |
TCG |
TAG |
|
start |
h |
e |
m |
o |
i |
l |
o |
b |
i |
n |
. |
Hemoilobin is what it then reads. If this were a real protein, it would mean that the protein would no longer function as it should, or less well than it should. Remember the robots. If one random part were replaced for no reason, strange things could happen. If a wheel is not properly placed, it would go only half as fast. If a screw in its back is missing, there is hardly a problem. If its thumb is replaced by an eye, it is possible that the whole robot can no long perform its function, even though it would still look like a robot. With proteins, a copy of the function is usually also found on the gene on the other chromosome, but if that one is also damaged, the whole function of the gene-pair/protein is nullified. In the case of a human, the carrier of such a damaged gene or gene-pair could then have a hereditary disease. Or, if he does not become ill as a direct result of the loss of that function, perhaps he has white(r) skin or blue eyes (there is no or too little pigment being produced in the skin or the irises).
These changes in genetic letters are known in biology as point mutations. Besides the changing of a letter, a letter could also completely disappear (a deletion). This could be the result:
ATGCAGCGAATGTTTGAGAAGCTCGATGGCTCGCGCTAG
ATGCAGGAATGTTTGAGAAGCTCGATGGCTCGCGCTAG
|
ATG |
CAG |
CAA |
TGT |
TTG |
AGA |
AGC |
TCG |
ATG |
GCT |
CGT |
AG |
|
start |
h |
g |
f |
o |
e |
n |
n |
m |
a |
e |
|
hgfoennmae is what is written, and this could continue until a TAG or other ‘point’ is coincidentally found. This becomes nonsense. With a real protein, it also becomes nonsense. If a letter is added (an insertion), it results essentially in the same thing. So this can never happen; if it does, you get a big mess. It throws the whole blueprint of the protein-robots into confusion. Of the different kinds of mutations, the point mutation is therefore the least destructive. There are also various security proteins that do their best to prevent mutations. The structure of the genetic code itself is also set up to minimize the effects mutations have as much as possible.
The degeneration of the genetic code serves a protective function; the many codons for a single amino acid often are quite similar; for example, four of the six codons for leucine begin with CU, no matter what the third base is. Because of this similarity, a point mutation in the third place will not lead to an incorrect amino acid being placed in a protein.Biology, pp. 300
Still, mutations do occur. For instance, under the influence of radiation or ultraviolet light, the number of mistakes made exceeds the amount the repair proteins can restore, so that they ‘drop stitches’ and mistakes creep into the DNA. There are also chemicals which are known to cause mutations. On average, one mutation can happen per person before it makes a difference and is not deadly.[7]
A practical example of variants of a original protein generated by mutations: In humans, there are three versions, or alleles, of the gene that determines blood group: A, B, and O. There are two positions for a gene (on the double chromosomes), so the following combinations are possible:
| gene |
bloodgroup |
O + O |
|
O
|
|
| O + A |
|
A |
|
| A + O |
|
A |
|
| O + B |
|
B |
|
| B + O |
|
B |
|
| A + A |
|
A |
|
| B + B |
|
B |
|
| A + B |
|
AB |
|
| B + A |
|
AB |
|
Bloodgroup A means that it can receive other blood with bloodgroup A in a bloodtransfusion, but that antibodies are produced against B, if the blood would contain that bloodgroup. Bloodgroup B means that it can receive bloodgroup B, but that antibodies against A will be produced. If you have bloodgroup AB no antibodies are produced at all, so you can receive any A, B or AB bloodgroup. Bloodgroup O would produce antibodies against any bloodgroup A or B during a transfusion. However, mutations do occur in blood groups A or B, which is why there are now people with blood groups A* or B+. In reality, those are A and B genes with a slight alteration, so that they produce antibodies which are not quite the real A or B. In this way, ten different versions of one gene could occur, but only if the protein created by that gene is not essential for the organism to stay alive. A mutation in, for instance, a Make-A-Protein gene[8] would immediately mean that no more proteins could be produced. Sex cells with such serious flaws will never result in viable offspring.
Summarize
- A gene is precisely defined and stores information for the production of specialized robot-proteins.
- The function of a gene is predetermined according to a precise pattern.
- Mutations are damage to or even elimination of existing and operative genes. They create chaos in the highly ordered system which exists in DNA. It is a loss of information.
- DNA has an anti-mutation attitude. There are no biochemical or genetic mechanisms which cause these mutations, only mechanisms which attempt to prevent and repair them.[9] The genetic code is set up in such a way that it attempts to oppose the effect of mutations.
- Mutations do not occur frequently. They appear coincidentally. Most of them make no difference. Many are damaging or deadly.
4.6 Mutations – evolutionary miracles? What is so special about mutations? Well, they disturb Mendel’s standard pattern, since mutations are random changes, in contradiction to the hereditary characteristics according to the rules which Mendel discovered. Mutations break the natural limit placed on variation. Because of mutations, DNA is not a given; it becomes a dynamic whole, and can ‘grow’ from one genome to another by an accumulation of small alterations. Because of mutation, variation is not finite after all, as Wallace feared and the reason he rejected Mendel, but is in its own way ‘infinite’. The Dutchman Hugo de Vries came up with a ‘mutation theory’, which he published in 1901-1903. He presented his own version of Darwin’s selection mechanism: evolution does not happen through selection of the most well-adapted individuals within a species, but through selection of the most well-adapted mutant who generates a new species. Finally, in the thirties and forties, the so-called ‘neo-Darwinistic synthesis’ took place, in which Darwin’s concept of evolution and Mendel’s heredity met, thanks to the idea that all sorts of spontaneous changes, or mutations, could appear in the hereditary material. As a result, a species is just as ‘changeable’ as the environment in which it lives and is able to evolve with it.
The extremely important question here is: does new variation originate through mutation?[10] The answer is: Yes. But it is important to keep in mind how mutations do that. Mutations damage genes. Because each gene has a double, this is usually not a problem; the ‘good’ gene will take over. However, if such a damaged gene becomes a homozygote (can be found on both chromosomes), the function of that gene is completely eliminated. It just depends on how important that gene was for the organism. A human can survive without an arm, or without a spleen, he can survive with only one kidney, or with particularly little pigment (white skin) or without brown eyes. In all these cases, existing functions are cancelled. Only in the case of the loss of pigment did those people have a better chance of survival in areas with little sunlight, and you can see that the further north you go, the lighter the skin color is. There is no improvement, or an increase in complexity. I will come back to this in detail (in chapters 6 and 13), so ‘hold your horses’.
The problem I am outlining here is: are mutations capable of making new specialized protein-robots and/or producing new genetic constructions which are necessary to make new organs which again have their own specific functions in the body. In other words, are mutations capable of causing structural evolution on a large scale. Mutations are mistakes in an organized system. How can this result in a new, never before encountered, organized system, such as when a reptile becomes a bird or a mammal? Do such complex systems originate from a chain reaction of mistakes? To make a comparison: Suppose that a manual for making a typewriter is typed on a typewriter. That is, after all, essentially what DNA does: describe the proteins which give the DNA the impulse to produce proteins (and the impulse for self-duplication, recombination, and the suchlike). Furthermore, the manual can probably be described using an alphabet of 20 letters, which corresponds to the 20 amino acids of proteins. Is it now possible that the typewriter originated by an accumulation of typing errors in the manual’s description? Of course not. Will typing errors lead to ‘other’ typewriters? Most likely, but where is the limit and where does it lead?
Therefore, the best thing we can do now is to listen to what the proponents of the evolution theory have to say about it. We will let some of them speak in the next chapter in order to form a picture of the present state of affairs in the evolution theory. Afterwards, in chapters 6 and 7, we will test the mechanisms for macro-evolution which they propose, in order to see if they can withstand the test of criticism.
points of attention
- Apparently, in one way or another, each organism has genes which can put up with being ‘on’ or ‘off’ (such as the genes which make pigment), or sometimes with being only partly capable of doing what they need to do, without it directly affecting the viability.
- Point mutations change only genes which already exist. Point mutations cannot make new genes, only variants of existing genes.
- Point mutations use or actually abuse the system of natural variation.
- To say that the system for natural variation originated through point mutations is the same as saying that the typewriter originated through typing errors! Or that computer programs originated through mistakes in copying!
| List of difficult words: |
| amino acids: |
|
The building blocks of proteins. Twenty different amino acids occur in the proteins all living things use. |
| base (pair): |
|
The building blocks of DNA. There are four of them: Thymine, Adenine, Cytosine en Guanine, respectively T, A, C and G. T and A have two hydrogen bonds, whereas C and G have three. That is why A and T always are across from C and G respectively in DNA, thus forming base pairs. |
| codon: |
|
In groups of three base pairs, the bases define one of the twenty amino acids which needs to be in a protein. Such a group of three is called a codon. |
| protein: |
|
A three-dimensional, specialized, biochemical robot, made of amino acids, which carried out specific functions in cells and in the body. They are also called ‘enzymes’, or sometimes ‘hormones’. |
| genetic code: |
|
Because there are four bases, and three bases form a codon, there are 64 possible codons, but only twenty amino acids which occur in proteins. The genetic code is the table in which each codon indicates only one amino acid, and an amino acid is indicated by several codons. In the genetic code, there is also a beginning codon (start here with protein production) and three end codons (stop here with protein production). |
| mutation: |
|
An alteration in base pairs in the DNA. Mutations can be point mutations, insertions, or deletions. Point mutations change one single base pair into another, for instance from T-A to A-T or G-C. Insertions add a base pair, and deletions remove one. |
|
|
|